The name of the primary motif.

[ close ]

The logo of the primary motif.

Sections of the motif with a gray background have been trimmed and were not used for scanning.

[ close ]

The number of secondary motifs found that had significant spacings in the tested region.

[ close ]

The list of secondary motifs found that had significant spacings in the tested region.

[ close ]

The name of the sequence database.

[ close ]

The last modified date of the sequence database.

[ close ]

The number of sequences in the sequence database.

[ close ]

The number of sequences in the sequence database which were excluded because they were shorter than twice the margin plus the primary motif length.

[ close ]

The number of sequences in the sequence database which were excluded because no match to the primary motif could be found at a distance to the edges larger than the margin.

[ close ]

The number of sequences in the sequence database which were excluded because they were largly identical to other sequences when aligned on the primary motif site.

[ close ]

The number of sequences which were scanned with the secondary motifs.

[ close ]

The name of the motif database derived from the file name.

[ close ]

The date that the motif database was last modified.

[ close ]

The number of motifs loaded from the motif database. Some motifs may have been excluded.

[ close ]

The number of motifs with significant E-values whose significant spacings were not considered too similar to those of another motif.

[ close ]

The number of motifs that while having significant spacings were less signficant than another motif that matched most of the same sites.

[ close ]

The primary motif is used as the reference point for all spacing calculation.

Sections of the motif with a gray background have been trimmed and were not used for scanning.

[ close ]

The secondary motif occurs at the spacings relative to the primary shown in the histogram below.

Sections of the motif with a gray background have been trimmed and were not used for scanning.

[ close ]

The E-value is the lowest p-value of any spacing of the secondary motif times the number of secondary motifs. It estimates the expected number of random secondary motifs that would have the observed minimum p-value or less.

[ close ]

The histogram below shows the frequency of spacings from the primary motif to the secondary motif. Red bars indicate that a spacing has occured a statistically significant number of times.

Upstream
These are sequences where the secondary motif occurs before the primary motif.
Downstream
These are sequences where the secondary motif occurs after the primary motif.
Same Strand
These are sequences where the secondary motif is on the same strand as the primary motif.
Opposite Strand
These are sequences where the secondary motif is on the opposite strand to the primary motif.
[ close ]

The details of the significant spacings are shown in the four quadrants as they relate to the quadrants of the graph.

P-value
is the probability of the observed number (or more) sequences having the observed spacing between the primary and secondary motif, adjusted for multiple tests. The number of multiple tests is the number of spacing bins (the number of bars in the histogram) tested for significance.
Gap
is the space between the primary and secondary motifs where a value of zero means there is no space between them.
#
is the number of sequences where that spacing was observed.
[ close ]

The total number of sequences that have a match for both the primary motif and this secondary motif.

[ close ]

The motif database which this secondary motif came from.

[ close ]

The list of secondary motifs which have been identified as possibly similar to this motif because their most significant spacings overlaped with the most significant spacing of this motif. Check the boxes to show the possibly similar secondary motifs.

[ close ]

This shows the first secondary motif aligned with the current secondary motif by the most significant spacing.

Sections of the motif with a gray background have been trimmed and were not used for scanning.

[ close ]

For further information on how to interpret these results or to get a copy of the MEME software please access http://meme.nbcr.net.

If you use SpaMo in your research please cite the following paper:
Tom Whitington, Martin C. Frith, James Johnson and Timothy L. Bailey, "Inferring transcription factor complexes from ChIP-seq data", Nucleic Acids Research, 39(15):e98, 2011. [full text]

Primary Motif  |  Sequence Database  |  Secondary Databases  |  Spacing Analysis  |  Program information

Primary Motif

Next Top
Name 
Preview 
Significant Secondaries 
List 
UP00035 2 (Hic1 secondary)
GGGTGTGCCCAAAAGG
5 MA0117.1 (Mafb),  UP00132 1 (Evx2 2645.3),  UP00048 1 (Rara primary),  MA0068.1 (Pax4),  UP00162 1 (Evx1 3952.2)

Sequence Database

Previous Next Top
Name 
Last Modified 
Loaded 
Too Short 
No Primary 
Too Similar 
Used 
Static Male-biased Wed Jun 7 10:44:38 2017 1954 0 1302 0 652

Secondary Databases

Previous Next Top
Name 
Last Modified 
Number of Motifs 
Motifs Significant 
Motifs Redundant 
meme.xml Wed Jun 7 10:46:46 2017 3 0 0
dreme.xml Wed Jun 7 10:48:38 2017 10 0 0
JASPAR CORE 2014 vertebrates Wed Jun 7 10:44:14 2017 205 2 0
uniprobe mouse Wed Jun 7 10:44:14 2017 385 3 0

Spacings of "MA0117.1 (Mafb)" relative to "UP00035 2 (Hic1 secondary)"

Previous Next Top
Primary: UP00035 2 (Hic1 secondary) 
Secondary: MA0117.1 (Mafb) 
E-value
GGGTGTGCCCAAAAGG
GCTGACGC
2.7
Motif Spacing Histogram 
  Significant Motif Spacings (p<0.05) 
 
Upstream Downstream   Upstream Downstream Other Details
Same Strand
Opposite Strand
P-value Gap #  
0.0044 5 7  

Total sequences with primary and secondary motif 

399

Motif Database 

JASPAR CORE 2014 vertebrates

Spacings of "UP00132 1 (Evx2 2645.3)" relative to "UP00035 2 (Hic1 secondary)"

Previous Next Top
Primary: UP00035 2 (Hic1 secondary) 
Secondary: UP00132 1 (Evx2 2645.3) 
E-value
GGGTGTGCCCAAAAGG
CACCGCTAATTAGCGTT
4.5
Motif Spacing Histogram 
  Significant Motif Spacings (p<0.05) 
 
Upstream Downstream   Upstream Downstream Other Details
Same Strand
Opposite Strand
P-value Gap #  
0.0075 105 3  

Total sequences with primary and secondary motif 

25

Motif Database 

uniprobe mouse

Spacings of "UP00048 1 (Rara primary)" relative to "UP00035 2 (Hic1 secondary)"

Previous Next Top
Primary: UP00035 2 (Hic1 secondary) 
Secondary: UP00048 1 (Rara primary) 
E-value
GGGTGTGCCCAAAAGG
TCTCAAAGGTCACCTG
5.4
Motif Spacing Histogram 
  Significant Motif Spacings (p<0.05) 
 
Upstream Downstream   Upstream Downstream Other Details
Same Strand
Opposite Strand
P-value Gap #  
0.009 6 6  

Total sequences with primary and secondary motif 

292

Motif Database 

uniprobe mouse

Spacings of "MA0068.1 (Pax4)" relative to "UP00035 2 (Hic1 secondary)"

Previous Next Top
Primary: UP00035 2 (Hic1 secondary) 
Secondary: MA0068.1 (Pax4) 
E-value
GGGTGTGCCCAAAAGG
GAAAAATTTCCAATACTCCACTCCCCCCCC
6.5
Motif Spacing Histogram 
  Significant Motif Spacings (p<0.05) 
 
Upstream Downstream   Upstream Downstream Other Details
Same Strand
Opposite Strand
P-value Gap #  
0.011 102 6  

Total sequences with primary and secondary motif 

265

Motif Database 

JASPAR CORE 2014 vertebrates

Spacings of "UP00162 1 (Evx1 3952.2)" relative to "UP00035 2 (Hic1 secondary)"

Previous Next Top
Primary: UP00035 2 (Hic1 secondary) 
Secondary: UP00162 1 (Evx1 3952.2) 
E-value
GGGTGTGCCCAAAAGG
AGAACTAATTAGTGGAC
7.4
Motif Spacing Histogram 
  Significant Motif Spacings (p<0.05) 
 
Upstream Downstream   Upstream Downstream Other Details
Same Strand
Opposite Strand
P-value Gap #  
0.012 130 4  

Total sequences with primary and secondary motif 

88

Motif Database 

uniprobe mouse
Previous Top
SpaMo version
4.10.0 (Release date: Wed May 21 10:35:36 2014 +1000)
Reference
Tom Whitington, Martin C. Frith, James Johnson and Timothy L. Bailey, "Inferring transcription factor complexes from ChIP-seq data", Nucleic Acids Research, 39(15):e98, 2011.
Command line summary

Result calculation took 23 seconds
Note that the random number generator was initilized with a seed of 1 so you need "-numgen 1" in the list of arguments to replicate the experiment.
show model parameters...